RSS

PENYAKIT SURRA

LEARNING OBJECTIVE
1) PENYAKIT SURRA

  • ETIOLOGIS
  • PATOGENESIS & RESPON RAGAWI
  • GEJALA KLINIS
  • DIFFERENTIAL DIAGNOSA
  • DIAGNOSIS
  • PROGNOSA
  • PENANGANAN

Trypanosomiasis (Surra)
Etilogik : Trypanosoma evansi
Lokasi : darah, limpa, dan cairan serebrospinal
Penularan : mekanik murni oleh vektor, puncaknya pada siang hari, congenital lewat induk atau plasma, mukosa kelamin, mukosa usus, dan luka terbuka. Di tubuh lalat hidup bertahan selama kurang lebih 6-12 jam.

Patogenesis
Vektor utama adalah lalat dan nyamuk (Stomoxys calcitrans, Lyperosia, Glossina dan Tabanus). Trypanosoma evansi diketahui hanya berbentuk tunggal (monomorfik) berbeda dengan spesies lain yang berbentuk ganda (pleomorfik). Dalam keadaan tertentu, protozoa ini tidak dapat tertangkap saat dilakukan pemeriksaan karena dapat bersembunyi di dalam kelenjar limfe (Subronto, 2006).
Penyakit Tripanosomiasis ditularkan secara mekanik melalui gigitan vektor setelah ia menghisap darah penderita, baik hewan ternak maupun anjing. Setelah memasuki peredaran darah, trypanosoma segera memperbanyak diri secara biner. Dalam waktu pendek penderita mengalami parasitemia dan suhu tubuh biasanya mengalami kenaikan. Sel darah penderita yang tersensitisasi oleh parasit segera dikenali oleh makrofag dan dimakan oleh sel darah putih tersebut. Bila sel darah merah yang dimakan makrofag cukup banyak anjing penderita segera mengalami anemia normositik dan normokromik. Sebagai akibat anemia, penderita tampak lesu, malas bergerak, bulu kusam, nafsu makan menurun dan mungkin juga terjadi oedem di bawah kulit maupun serosa (Subronto, 2006).
Jenis Trypanosoma yang dalam siklus hidupnya hanya terdapat satu stadium, contoh T. Equiperdum dan T. Evansi, disebut monomorf, dan perlipatgandaannya berlangsung dengan pembelahan biner. Trypanosoma yang dalam hidupnya terdapat 2 atau lebih stadium, disebut polimorf, contoh: T. Gambiense, T. Rhodesiense, T. Brucei, dan sebagainya.
Dalam tubuh vertebrata, stadium terakhirnya adalah Trypanosoma. Jika bersama darah stadium tadi ditelan oleh serangga, dalam saluran pencernaan parasit itu mengalami perubahanbentuk melalui satu atau lebih stadium, yaitu stadium Leishmania, Leptomonas, atau chritidia. Tiga macam stadium itu tidak infektif bagi vertbrata. Stadium yang infektif adalah tripanosoma metasiklik. Parasit bentuk infektif ini dikeluarkan bersama tinja serangga, dan penularan terjadi bila tinja yang mengandung tripanosoma metasiklik itu kontak langsung dengan kulit vertebrata inang. Masuknya parasit bentuk infektif ke dalam tubuh inang dipermudah oleh luka karena gigitan serangga atau karena luka goresan atau garukan (Mukayat, 1987).
Gejala Klinis

  • Suhu badan naik, demam bersalng-seling, anemi, muka pucat
  • Nafsu makan berkurang, sapi menjadi kurus dan berat badan menurun
  • Penderita tak mampu bekerja karena letih
  • Bulu rontok, kelihatan kotor, kering seperti sisik
  • Terjadi gerakan berputar-putar tanpa arah, bila parasit ini menyerang otak atau syaraf (Girisonta, 1995).

Differential Diagnosa
T. congolense; Di daerah Afrika sub sahara, penyebab nagana (sleeping sickness), lebih patogen daripada brucei, pada sapi, kerbau dan hewan liar, didapat di dalam darah, bentuk dalam darah: kecil (8 – 12 μ), membrana undulan jarang terlihat tidak ada flagela bebas, ditularkan oleh lalat tse-tse, mekanis oleh lalat penggigit.
T. vivax; Kadang-kadang bersama dengan T. Brucei dan T. Congolense, patogenitas lebih ringan pada sapi, di daerah Afrika sub-sahara, panjangnya: 20 – 27 μ, posterior membulat satu flagellum bebas, membrana undulans tidak jelas, kinetoplas besar di terminal.
T. brucei; Berparasit pada semua mamalia, ruminansia liar di Afrika, bersifat fatal, penyebab penyakit nagana, ruminan liar sebagai reservoir, T. gambiense dan T. Rhodesiense → penyakit tidur di Afrika pada manusia.
T. gambiense pada sapi; Bentuk lebih langsing, buntak, berparasit dalam darah, limfe dan cairan cerebrospinal, ukuran ± 29 μ – 42 μ, posterior meruncing, kinetoplas 4 μ dari ujung, flagella bebas dan panjang, penularan: lalat tse-tse (genus Glossina), berbiak dalam darah atau limfe, pembelahan ganda memanjang, lokasi di lalat: di usus bagian tengah → 10 hari trypomastigot → proventrikulus → oesophagus → faring → kelenjar ludah → epimastigot → tripometasiklik pendek → diinfeksikan ke hospes saat menghisap darah, penularan lalat tse-tse, lalat kuda dan Tabanidae → vektor mekanis.
T. equinum; Terdapat di Amerika Selatan, menyebabkan mal de caderas pada kuda (sapi, anjing, domba, kambing), mirip dengan penyakit surra, beda dengan T. evansi (tidak ada kinetoplas), mungkin penjelmaan dari T. Evansi, morfologi: → 35 μm, vektor: Tabanidae (Stomoxys), pada kuda berjalan secara kronis, kehilangan tenaga → kelumpuhan.
T. equiperdum; Ada di seluruh dunia, pada kuda, sapi, keledai → penyakit dourine, ditemukan pada darah dan limfe, menyerupai evansi, tetapi menyebabkan penyakit kelamin, ditularkan melalui coitus (kawin). Morfologi: 16 – 35 μm, monomorf, kinetoplas sub-terminal, plasma bergranula. Berjalan klinis pada 3 stadium: organ genital – kulit – saraf pusat (CNS) setelah 1 – 4 minggu inkubasi → stadium primer (genitas ) → oedem, keradangan di penis, praeputium dan organ genital lain → beberapa jam → ulcer. Pada betina → vaginitis → disertai demam. Stadium sekunder → urtikaria → reaksi dermatologis → hemoragi kulit. Stadium tertier → gangguan sistem saraf pusat → paralisa → refleks extremitas menurun → gangguan beberapa nervus mata/muka. Pada dourine, menciri pada sekresi cairan genital, infeksi kulit,preparat apus darah → parasitemia kuat saja. Diagnosa immunologis: CBR.
T. theileri; Berparasit dalam darah sapi di seluruh dunia, biasanya tidak patogen, bentuk relatif besar, 35 – 70 μm (120 μm pernah dilaporkan), ditularkan oleh Tabanus dan haematopota, ujung posterior panjang dan runcing, membarana undulan jelas flagela bebas, dalam darah: tripomastigot – epimastigot, ditularkan melalui tinja lalat, pada beberapa kasus produksi susu mengalami penurunan dan aborsi,
T. rangeli; Parasit pada darah anjing, kucing, kera di Amerika selatan dan tengah, Non-patogen, harus dibedakan dengan T. Cruzi, ukuran 26 – 36 μm, kinetoplas kecil, reproduksi binary fission, ditularkan oleh kutu pencium dengan pencemaran tinja.
Trypanosoma cruzi (chagas disease); Berparasit pada manusia di Amerika Selatan dan tengah, pada hewan liar, armadillo, kus – kus → reservoir (termasuk tikus), 5 juta orang terinfeksi di Brazil 2 juta di venezuella/Columbia, penyakit serius dan mematikan pada manusia (37 juta di seluruh dunia terinfeksi) bentuk tripomastigot di darah, tetapi tidak membiak masuk ke dalam retikuloendotelial dan otot melintang → amastigot → berbiak predileksi di urat daging jantung, tripomastigot: 16 – 20 μm, posterior runcing, flagela bebas, membrana undulan sempit, vektor: kutu pencium hemiptera, gambaran penyakit: kerusakan organ dalam, sistem syaraf pusat. Otot jantung → rusak, berbahaya pada anak kecil.

Diagnosis
Penentuan diagnosis didasarkan pada ditemukannya parasit dalam pemeriksan darah natif atau dengan pengecatan HE atau dengan trypan-blue (Subronto, 2006).
Pada stadium akut atau awal dari penyakit ini tripanosoma dapat ditemukan di dalam aliran darah perifer. Usapan darah tebal lebih baik dipakai daripada usapan darah tipis pada pemeriksaaan ini. Protozoa ini lebih banyak ditemukan di dalam kelenjar limfa. Mereka juga dapat ditemukan di dalam usapan cairan yang diperoleh dari tusukan kelenjar limfa yang segar atau yang telah diwarnai. Pada stadium lebih lanjut dapat ditemui pada cairan serebrospinal (Levine., N.D. 1995).

Prognosa
Sebagian besar hewan yang terkena penyakit tripanosomiasis ini mengalami kematian. Penyakit ini lebih menahun pada sapi dan banyak yang menjadi sembuh. Pada kuda, bagal, dan keledai sangat rentan, serta domba, kambing, dan onta juga sangat rentan, tanda-tandanya sangat mirip dengan kuda (Levine., N.D. 1995).

Penanganan
Tindakan-tindakan preventive terhadap tripanosomiasis meliputi tndakan-tindakan yang ditujukan kepada hospes-hospes pengelolaan ternak, melenyapkan hospes reservoir, menghindakan kontaminasi mekanis yang tidak disengaja, pengelolaan penggunaan tanah, dan pengendalian biologic. Survey terus-menerusdan pengobatan atau penyembelihan semua hewan yang terserang dan pengobatan secara missal secara periodic semua hewan. Meenyapkan tempat perindukan secara besar-besaran karena lalat berkembang biak di bawah semak-semak sepanjang sungai atau di lokasi-lokasi lain yang bersemak. Pelepasan jantan-jantan steril untuk mengendalikan dan penyemprotan tanah dengan DDT (Levine., N.D. 1995).
Untuk menyembuhkan infeksi T. evansi pada kuda dan anjing WHO menganjurkan pemakaian kuinapiramin (antrycide), diberikan secara subkutan sebagai sulfat yang dilarutkan dalam konsentrasi 10% dalam air dingin; dosisnya 5 mg/kg berat badan (Levine., N.D. 1995).
Suramin larutan 10%, dosis 10 mg/kg berat badan, disuntikkan IV, diminazene aceturat, dosis 3,5 mg/kg, disuntikkan IM, dan isometamedium, dosis 0,25 – 0,5 mg/kg disuntikkan IM (Subronto., 2006).

DAFTAR PUSTAKA

Girisonta., 1995. Petunjuk Praktis Beternak Sapi Perah. Kanisius. Yogyakarta.

Levine., N.D. 1995. Protozoologi Veteriner. Gadjah Mada University Press. Yogyakarta

Mukayat., D Brotowidjoyo. Parasit dan Parasitisme. Jakarta: PT Melton Putra

Subronto., 2006. Penyakit Infeksi Parasit & Mikroba pada Anjing & Kucing. Gadjah Mada University Press. Yogyakarta.

 
Tinggalkan komentar

Ditulis oleh pada 3 Maret 2011 in penyakit SURRA

 

Flu Burung

PENGENDALIAN INFEKSI PADA PERAWATAN FLU BURUNG
Mikroorganisme Penyebab:
HPAIV: Highly Pothogenic Avian Influenza Virus

Sumber infeksi:
Di Komunitas: Unggas
Di Rumah Sakit: Pasien, Petugas Kesehatan, Pengunjung

Pejamu:
Di Rumah Sakit: Pasien, Petugas Kesehatan, Pengunjung

Cara Penularan:

Kontak : Langsung dan tidak langsung
Penularan terjadi pada kontak langsung dari kulit pasien ke kulit pejamu rentan lain, dalam hal ini petugas kesehatan pada saat memandikan pasien atau melaksanakan tindakan keperawatan yang lain.
Secara tidak langsung dengan melibatkan benda perantara, yang biasanya benda mati seperti alat kesehatan, jarum, kasa pembalut, tangan yang tidak dicuci, sarung tangan bekas.

Droplet:
Meskipun secara teori penularan droplet atau melalui percikan merupakan bentuk lain dari penularan secara kontak, namun mekanisme perpindahan kuman patogen dari pejamunya sangat berbeda dengan sebagaimana kontak langsung maupun tidak langsung. Percikan dihasilkan oleh pejamu (yang berdiameter > 5m) melalui batuk, bersin, bicara dan selama pelaksanaan tindakan tertentu seperti penghisapan lendir dan bronkoskopi. Percikan yang berasal dari pejamu tersebut terbang dalam jerak dekat melalui udara dan mengendap di bagian tubuh pejamu lain yang rentan seperti: konjungtiva, mukosa hidung, atau mulut.
Oleh karena percikan yang mengandung kuman tersebut tidak menetap di udara maka untuk mencegah penyebaran lebih lanjut tidak diperlukan pengaturan khusus pada sistem ventilasi, jangan dikacaukan dengan penularan airborne.
Kewaspadaan terhadap penularan yang diperlukan
Kewaspadaan Universal
Memperlakukan semua darah dan cairan tubuh sebagai bahan infeksius, hindari menjamahnya dengan tangan telanjang atau segera cuci bila mungkin tercemar
Cuci tangan (dengan air mengalir dan sabun/antiseptik, gosok selama 10 detik, dan lap kering) sebagai tindakan rutin: sebelum dan setelah menjamah pasien, seblum memakai dan setelah melepas sarung tangan
Sarung tangan pemeriksaan bila akan menjamah darah dan duh tubuh atau benda tercemar lain. Ganti sarung tangan setiap ganti pasien. Lepas segera sarung tangan setelah selesai tindakan.
Masker, kaca mata, pelindung wajah dikenakan bila ada kemungkinan terjadi percikan darah, duh tubuh lain selama melakukan tindakan atau perawatan pasien.
Kewaspadaan tambahan
terhadap penularan melalui kontak dan percikan (droplet)
Sebagai tambahan pada kewaspadaan universal

Penempatan pasien :
Pasien ditempatkan dalam ruang tersendiri. Bila tidak tersedia ruang tersendiri dapat ditempatkan bersama pasien dengan diagnosis yang sama (kohort).
Alat pelindung yang diperlukan
Semua petugas kesehatan harus selalu mengenakan alat pelindung sbb:
ketika masuk ke ruang pasien:
Kenakan masker, penutup kepala, kaca mata pelindung, sarung tangan, gaun pelindung, sepatu pelindung, ketika memasuki ruang pasien
Selama melaksanakan tindakan, ganti sarung tangan setelah menjamah bahan infeksius.
Gaun pelindung (tidak perlu steril), pilih yang sesuai dengan tindakan yang akan dilaksanakan (kedap air atau tidak).
Lepas gaun sebelum meninggalkan ruangan dan pastikan baju kerja tidak terkontaminasi.
Lepas sarung tangan sebelum keluar ruangan dan cuci tangan segera dengan antiseptik dan pastikan setelahnya tidak lagi menjamah permukaan di ruang pasien yang mungkin tercemar.
Demikian pula dengan alat pelindung yang lain

Transportasi Pasien :
Batasi pemindahan pasien ke ruang lain kecuali sangat diperlukan. Bila terpaksa maka pasien kenakan masker pada pasien dan selimut bersih rapat, pastikan kewaspadaan universal tetap terjaga untuk menekan risiko penyebaran mikroorganisme ke pasien lain dan pencemaran permukaan lingkungan atau peralatan lain.
Alat kesehatan untuk pasien
Bila mungkin alokasikan alat kesehatan khusus untuk pasien tersebut atau bersama dengan pasien sejenis untuk menghindari penyebaran antar pasien. Bila menggunakan alat untuk pasien umum, maka perlu pembersihan yang memadai dan disinfeksi sebelum dipakai untuk pasien lain.

INFORMASI TENTANG FLU-BURUNG

1. Apa yang disebut Flu-Burung ?

Flu Burung adalah penyakit yang disebabkan oleh virus influenza yang menyerang burung/unggas/ayam . Salah satu tipe yang perlu diwaspadai adalah yang disebabkan oleh virus influenza dengan kode genetik H5N1 (H=Haemagglutinin, N=Neuramidase) yang selain dapat menular dari burung ke burung ternyata dapat pula menular dari burung ke manusia.

2.Siapa yang harus diwaspadai Dan bagaimana gejala klinisnya apabila menyerang manusia
Yang harus diwaspadai adalah
a) apabila seseorang bekerja di laboratorium yang memproses sample dari pasien atau binatang yang terinfeksi atau
b) 1 minggu yang lalu bekerja atau mengunjungi peternakan/tempat penyembelihan ayam/unggas di daerah yang terjangkit atau
c) kontak dengan penderita Flu Burung HPAI (Highly pathogenic Avian Influenza) atau lebih spesifik virus H5N1 pada saat penyakit itu mudah menular dan kemudian menderita penyakit dengan gejala : panas lebih dari 38 derajat celcius, batuk, dan sakit tenggorokan. Pasien seperti ini oleh WHO disebut Possible case of Influenza A (H5N1).
Keadaan itu dapat menjadi semakin berat jika timbul pneumonia disertai sesak nafas (radang paru) dan menyebabkan angka kematian yang tinggi (Tahun 1997 di Hongkong angka kematiannya 33,33% , atau 6 dari 18 kasus).

3.Berapa lama masa inkubasinya ? Dan apabila mengenai manusia berapa lama masa infeksiusnya ?
a) Masa inkubasinya sangat singkat yaitu 1 – 3 hari,
b) Meskipun belum terbukti adanya penularan dari manusia ke manusia , masa infeksiusnya (masa dimana penderita Avian Flu H5N1 diperkirakan mampu menularkan virus) adalah 1 hari sebelum tampak gejalanya dan 3-5 hari setelah tampak gejalanya dengan maksimum 7 hari (tetapi ada kepustakaan yang menyebutkan sampai 21 hari pada anak-anak).

4.Apakah penyakit itu menular dari menusia ke manusia seperti SARS ?
Sampai saat ini penularan dari manusia ke manusia belum terbukti. Sejauh ini penularan yang terjadi adalah dari burung/unggas/ayam yang terjangkit Flu-Burung ke manusia melalui kotoran atau sekreta burung yang mencemari udara dan tangan penjamah. Akan tetapi dari segi penyebaran wabah yang dikhawatirkan adalah jika Flu-Burung mengalami mutasi gen dan menjadi menular dari manusia ke manusia seperti yang terjadi pada SARS.
5.Siapa yang paling berisiko tinggi tertular Flu Burung ?
Mereka yang risiko tinggi adalah pekerja peternakan, penjual dan penjamah produk peternakan unggas/burung/ ayam. Pekerja laboratorium yang meneliti penyakit tersebut juga berisiko tinggi tertular. Anak-anak dan mereka yang berusia lanjut (60 tahun lebih) serta mereka yang dalam kondisi kekebalan rendah (pengguna obat steroid jangka panjang, obat sitostatika untuk kanker) merupakan kelompok yang rawan untuk terkena penyakit yang berat

6.Bagaimana pencegahannya ?
Rekomendasi sementara untuk pencegahan bagi mereka yang terlibat dalam peternakan/penyembelihan unggas/burung/ayam secara masal terutama di daerah terjangkit yang dikeluarkan oleh WHO/WPRO Manila 14 Januari 2004 intinya adalah sbb . :
a) Basuh tangan sesering mungkin, penjamah sebaiknya juga melakukan disinfeksi tangan (dapat dengan alcohol 70%, atau larutan pemutih/khlorin 0,5%untuk alat2/instrumen)
b) Gunakan alat pelindung perorangan seperti masker, sarung tangan, kaca mata pelindung, sepatu pelindung dan baju pelindung pada waktu melaksanakan tugas dipeternakan yang terjangkit atau di laboratorium
c) Mereka yang terpajan dengan unggas/burung/ayam yang diduga terjangkit sebaiknya dilakukan vaksinasi dengan vaksin influenza manusia yang dianjurkan oleh WHO dalam rangka mencegah infeksi campuran Flu-Manusia dengan Flu-Burung , yang kemungkinan dapat menyebabkan jenis virus Flu-Burung baru yang dapat menginfeksi manusia.
d) Lakukan pengamatan pasif terhadap kesehatan mereka yang terpajan dan keluarganya. Perhatikan keluhan-keluhan seperti Flu, radang mata, keluhan pernafasan). Orang berisiko tinggi terkena influenza yaitu mereka yang berusia lebih 60 tahun , atau berpenyakit paru dan jantung kronis tidak boleh bekerja di peternakan unggas/burung/ayam.
e) Lakukan survei serologis pada mereka yang terpajan termasuk kepada dokter-hewan
f) Jika terdapat risiko untuk menghirup udara yang tercemar di peternakan /tempat penyembelihan yang terjangkit , diajurkan pencegahan dengan obat antiviral (antara lain dengan Oseltamivir 75 mg dalam kapsul , 1 kali sehari selama 7 hari).
g) Pemeriksaan laboratorium untuk memastikan dan mengisolasi virus penyebabnya : Kirimkan spesimen darah dan alat-alat dalam (usus, hati, hapusan hidung dan mulut, trachea, paru, limpa, ginjal, otak dan jantung) binatang yang diduga terjangkit penyakit itu (termasuk babi) ke laboratorium yang berwenang.

7.Apakah memakan daging ayam atau unggas dapat menularkan penyakit Flu-Burung
Kotoran dan sekreta cairan unggas yang terjangkit dapat menularkan apabila tidak di masak.
Pemanasan 90 derajat celcius dalam waktu 1 menit dapat mematikan virus tersebut.
Sumber : WHO : Avian Influenza-Fact Sheet 15 January 2004
Draft Case-Definitions Influenza A/H5N1.

sa
 

Penyakit Mulut “Hand Foot Mouth Disease”
Written by Bpk Memed Zoelkarnain Hasan
Monday, 16 March 2009 11:23
Pagi ini saya mendapatkan email berisi artikel yang bagus dari Pak Memed 

Beliau memberikan informasi kepada kita artikel ttg” penyakit Singapura Flu” atau Hand Foot Mouth Disease, sebagai bahan bagi warga GM untuk mengenal penyakit, yang saat ini sudah banyak dilaporkan berjangkit pada anak-anak balita . Minggu lalu 7 orang anak balita dari sebuah Playgoup di daerah BSD terjangkit. Walau tidak fatal, paling tidak bisa menambah pengetahuan kita ttg penyakit . Berikut Artikelnya :

A. Penyakit Mulut dan Kuku pada Hewan

Sinonim: Foot and Mouth Disease, Aphthae epizooticae

Penyakit mulut dan kuku (PMK) merupakan penyakit yang sangat ditakuti oleh banyak negara, terutama negara yang penghasilannya dari bidang peternakan cukup besar.  Menurut organisasi kesehatan hewan dunia Office International des Epizooties (OIE) yang berkedudukan di Paris, di mana Indonesia termasuk sebagai anggota, penyakit ini termasuk dalam daftar A, karena kerugian yang ditimbulkan sangat besar.  Penyakit ini menyerang hewan berkuku genap (sapi, kerbau, babi, kambing, dan domba).  Kerugian ekonomi yang ditimbulkan pada hewan berupa penurunan produksi susu dan daging, pelarangan ekspor, dan biaya pengendalian penyakit yang sangat besar.  Hewan liar berkuku genap, misalnya rusa, antelop, gajah, dan jerapah, dapat terserang PMK, tetapi onta tidak peka.

Angka kematian (case fatality rate) PMK pada hewan sangat kecil (kurang dari 3%), namun angka kesakitan (morbidity rate) sangat besar (dapat mencapai 90% atau lebih).  Kasus PMK pada manusia sangat jarang, hanya dilaporkan di luar negeri, dan tidak digambarkan secara jelas.  Pada kejadian wabah PMK di Pulau Jawa tahun 1983 dengan jumlah kasus yang sangat besar pada sapi, kerbau, kambing, dan babi, tidak ditemukan seorang pun yang tertular penyakit ini.

Saat ini Indonesia termasuk negara bebas PMK.  Selain Indonesia, negara yang bebas PMK adalah Australia, New Zealand, Amerika Serikat, dan Kanada.  Namun mengingat lalu lintas hewan dan produk hewan sangat pesat, dan beberapa negara tetangga di sebelah Utara Indonesia (Filipina, Thailand) belum bebas PMK, maka kewaspadaan terhadap masuknya kembali virus PMK ke Indonesia harus diwaspadai secara ketat.

Pada tahun 2002, terjadi wabah PMK di Jepang, Korea, dan Inggris.  Wabah PMK di Korea dan Jepang diduga disebabkan oleh pemasukan rumput asal China.  Pada kejadian wabah PMK di Inggris, sejumlah besar ternak terserang dan hewan yang berdekatan dimusnahkan.

1. Penyebab

Penyebab PMK adalah virus dalam Famili Picornaviridae, Genus Aphtovirus.  Ada tujuh tipe virus PMK, yakni A, O, C, Asia, South African Teritorry (SAT) 1, 2, dan 3.  Setiap tipe virus PMK masih terbagi lagi menjadi sub tipe dan galur (strain).  Sejauh ini di Indonesia hanya ada satu tipe virus PMK, yakni virus tipe O.

Virus PMK tahan dalam suhu beku, namun tidak tahan pada pH 6 atau lebih rendah.

Laboratorium referensi PMK internasional yang ditunjuk oleh Office International des Epizooties (OIE)/FAO adalah Animal Virus Research Institute yang terletak di Pirbright, sebuah kota kecil di sebelah Barat London, Inggris.  Di samping itu, ada pula laboratorium yang ditunjuk sebagai referensi regional, misalnya di Non Saray, Thailand, untuk wilayah Asia Tenggara.  Negara-negara yang tertular PMK mengirimkan spesimen untuk identifikasi virus ke laboratorium- laboratorium tersebut.

Virus PMK dapat terbawa oleh hewan yang sembuh selama 1-2 tahun (sapi) dan untuk waktu yang sangat lama (beberapa tahun) pada kerbau Afrika.

2. Sumber Penular

Sumber penular virus PMK adalah semua hewan yang peka terhadap virus PMK, yakni hewan berkuku genap.

3. Penularan

Pada hewan, penularan virus PMK umumnya terjadi secara kontak dalam kelompok hewan atau per os lewat makanan, minuman, atau alat-alat yang tercemar virus.  Meskipun virus PMK relatif peka terhadap lingkungan di luar tubuh hewan, namun angka kesakitan dapat sangat tinggi karena hewan tertular mengeluarkan virus dalam jumlah sangat banyak lewat ekskreta (tinja, urine), terutama air liur.

Penularan virus PMK dapat pula terjadi lewat bahan makanan beku yang mengandung tulang atau kelenjar limfe.  Sebenarnya, virus PMK dalam daging menjadi inaktif (mati) saat terjadi pelayuan daging, ketika pH daging menjadi asam, namun virus PMK yang berada di dalam sumsum tulang dan kelenjar limfe masih tetap hidup.  Oleh karena itu, beberapa negara mensyaratkan pengiriman daging dari negara tertular PMK tidak boleh mengandung tulang dan kelenjar limfe, di samping persyaratan lain.

Orang yang bertugas di kandang dokter hewan, dan petugas kesehatan hewan dapat menularkan penyakit dari suatu peternakan tertular ke peternakan lainnya lewat sepatu atau alat lain yang tercemar virus PMK.  Penularan secara aerosol (lewat udara) pernah terjadi di Inggris.

4. Gejala Klinik

a. Hewan

Masa inkubasi PMK bervariasi anatara 2-14 hari, tergantung pada masuknya virus.  Mula-mula gejala yang muncul adalah demam, tetapi sering tidak dikenali karena berlangsung sepat.  Lepuh atau vesikula pada lidah dan daerah interdigit (celah kuku) merupakan gejala yang mencolok, sehingga penyakit tersebut dinamakan penyakit mulut dan kuku.  Lepuh di lidah yang kemudian pecah, maka akan ditemukan hipersalivasi (air liur berlebihan) berwarna bening menggantung pada bibir.  Lepuh akan pecah meninggalkan ulkus dangkal.  Pada saat demikian, hewan terserang tidak mau makan, sehingga berat badan menurun drastis, sedangkan pada ternak perah, prodksi susu menurun.  Pada sapi, lepuh dapat pula ditemukan di puting dan kelenjar susu (mammae).

Lesi pada daerah inter-digit menyebabkan hewan pincang.  Apabila merupakan hewan penarik bajak atau pedati, maka hewan tersebut tidak dapat digunakan sebagai hewan kerja (penarik bajak, pedati).  Pada babi, di samping lesi pada lidah dan kuku, lepuh dapat ditemukan pada pinggir cungur (snout).

Kematian akibat serangan penyakit PMK sangat jarang terjadi.  Bila terjadi, kematian anak sapi, biasanya pada anak sapi tersebut tidak mau menyusu atau makan karena ada lepuh di mulut.

b. Manusia

Kasus PMK pada manusia sangat jarang terjadi dan tidak menimbulkan penyakit serius sehingga sering diabaikan.

5. Diagnosa

Pada sapi dan babi, gejala klinik PMK sulit dibedakan dengan vesicular stomatitis yang disebabkan oleh virus dalam Famili Rhabdoviridae, Genus Vesiculovirus.  Bila penyakit hanya terjadi pada babi, maka perlu dibandingkan dengan vesicular exanthema yang disebabkan oleh virus dalam Famili Caliciviridae.

Untuk isolasi virus, spesimen yang diambil dapat berupa jaringan lepuh pada lidah atau daerah inter-digit, yang dimasukkan ke dalam Phosphate Buffered Saline (PBS) pH 7,4 dan dikirimkan ke laboratorium referensi dengan pesawat udara dengan ketentuan yang memenuhi persyaratan pengiriman bahan biologik.

6. Pencegahan, Pengendalian, dan Pengobatan

Penyakit PMK pada hewan umumnya sembuh spontan tanpa pengobatan.  Di daerah endemik, pengobatan hanya ditujukan untuk infeksi sekunder oleh bakteria.

Ada beberapa tindakan pencegahan, pengendalian, dan pengobatan terhadap wabah PMK, tergantung pada perkiraan besarnya kerugian yang akan dialami dan kemamouan suatu negara.

Inggris melakukan tindakan stamping out, yaitu membunuh hewan tertular dan hewan lain yang berdekatan, kemudian mengubur bangkainya di daerah peternakan tersebut.  Sementara itu, lalu lintas hewan ditutup dan kandang tempat ternak sebelumnya didesinfeksi dengan larutan asam atau basa tertentu.

Di Indonesia, tindakan drastis seperti ini sulit dilakukan karena mendapat tentangan dari masyarakat pemilik hewan, seperti pernah terjadi di Bali sekitar tahun 1972.  Pemerintah memilih cara immunisasi massal terhadap semua hewan peka PMK selama tiga tahun berturut-turut di pulau tertular.

Vaksin yang digunakan untuk mencegah wabah PMK adalah vaksin inaktif dari galur virus yang sesuai.  Pada masa lalu, vaksin PMK di Indonesia diprodukdi oleh Pusat Veterinaria Farma yang terletak di Wonocolo, Surabaya.  Pada manusia, tidak dilakukan tindakan pencegahan secara khusus.

B. Penyakit Mulut dan Kuku pada Manusia

Flu Singapore atau Hand Foot Mouth Disease (HFMD)

1. Definisi

“Flu Singapore” sebenarnya adalah penyakit yang di dunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau dalam bahasa Indonesia Penyakit Tangan, Kaki, dan Mulut (PTKM).

Penyakit ini sesungguhnya sudah lama ada di dunia.  Berdasar laporan yang ada, kejadian luar biasa penyakit ini sudah ada di tahun 1957 di Toronto, Kanada.  Sejak itu terdapat banyak kejadian di seluruh dunia.  Di Indonesia sendiri sebenarnya penyakit ini bukan penyakit baru.

Istilah “Flu Singapore” muncul karena saat itu terjadi ledakan kasus dan kematian akibat penyakit ini di Singapura.  Karena gejalanya mirip flu dan saat itu terjadi di Singapura (dan kemudian juga terjadi di Indonesia), banyak media cetak yang membuat istilah “Flu Singapore”, walaupun ini bukan terminologi yang baku.

2. Penyebab

PTKM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil), Genus Enterovirus (non Polio).  Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus.  Di dalam Genus Enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus, dan Enterovirus.  Penyebab PTKM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 21.  Berbagai Enterovirus dapat menyebabkan berbagai penyakit.

3. Epidemiologi

Penyakit ini sangat menular dan sering terjadi pada musim panas.  PTKM adalah penyakit yang kerap terjadi pada kelompok masyarakat yang padat dan menyerang anak-anak usia 2 minggu sampai 5 tahun (kadang sampai 10 tahun).  Orang dewasa umumnya lebih kebal terhadap Enterovirus, walau bisa juga terkena.  Penularannya melalui jalur fekal-pral (pencernaan) dan saluran pernafasan, yaitu dari droplet (butiran ludah), pilek, air liur, tinja, cairan vesikel (kelainan kulit berupa gelembung kecil berisi cairan) atau ekskreta.  Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu.  Tidak ada vektor tetapi ada pembawa (“carrier”) seperti lalat dan kecoa.

Penyakit ini memberi imunitas spesifik, namun anak dapat terkena PTKM lagi oleh sirus strain Enterovirus lainnya.

Masa inkubasi 2-5 hari.

4. Gejala

Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (faringitis), tidak ada nafsu makan, pilek, gejala seperti “flu” pada umumnya yang tak mematikan.  Timbul vesikel yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan (lidah, gusi, pipi sebelah dalam) terasa nyeri sehingga sukar untuk menelan.  Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal di telapak tangan dan kaki.  Kadang-kadang rash/ruam (makulopapel) ada di bokong.  Penyakit ini umumnya akan membaik sendiri dalam 7-10 hari, dan tidak perlu dirawat di rumah sakit.  Bila ada gejala yang cukup berat, barulah penderita perlu dirawat di rumah sakit.  Gejala yang cukup berat tersebut antara lain:

-          Hiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39 0C

-          Demam tidak turun-turun

-          Takikardia (nadi menjadi cepat)

-          Takipneu, yaitu nafas jadi cepat dan sesak

-          Malas makan, muntah, atau diare berulang dengan dehidrasi

-          Letargi, lemas, dan mengantuk terus

-          Nyeri pada leher, lengan, dan kaku

-          Kejang-kejang atau terjadi kelumpuhan pada saraf kranial

-          Keringat dingin

-          Fotofobia (tidak tahan melihat sinar)

-          Ketegangan pada daerah perut

-          Halusinasi atau gangguan kesadaran

5. Komplikasi

Komplikasi penyakit ini adalah

-          Meningetis (radang selaput otak) yang aseptik

-          Ensefalitis (radang otak)

-          Myocarditis (Coxsackle Virus Carditis) atau pericarditis

-          Acute Flaccid Paralysis/Lumpuh layuh akut (“Polio like ilness”)

Satu kelompok dengan penyakit ini adalah:

1.       Vesicular stomatitis dengan exanthem (PTKM) – Cox A 16, EV 71 (Penyakit ini)

2.       Vesicular Pharyngitis (Herpangina) – EV 70

3.       Acute Lymphonodular Pharyngitis – Cox A 10

6. Diagnosa

Laboratorium:

Sampel (spesimen) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.. Spesimen dibawa dengan Hank’s Virus Transport.  Isolasi virus dengan cara biakan sel dengan suckling mouse inoculation.  Setelah dilakukan Tissue Culture, kemudian dapat diidentifikasi strainnya dengan antisera tertentu/IPA, CT, PCR, dll.  Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.

Diagnosa laboratorium adalah sebagai berikut:

1.       Deteksi virus:

-          Immuno histochemistry (in situ)

-          Imunofluoresensi antibodi (indirek)

-          Isolasi dan identifikasi virus

Pada sel Vero; RD; L20B

Uji netralisasi terhadap intersekting pools

Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum

2.       Deteksi RNA

RT-PCR

Primer: 5 CTACTTTGGGTGTCCGTGTT 3

5 GGGAACTTCGATTACCATCC 3

Partial DNA sekuensing (PCR Product)

3.       Serodiagnosis:

Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.

Uji ELISA sedang dikembangkan.

Sebenarnya secara klinis sudah cukup untuk mendiagnosis PTKM, hanya kita dapat mengetahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

7. Pengobatan

1.       Istirahat yang cukup

2.       Pengobatan spesifik tidak ada, jadi hanya diberikan secara simptomatik saja berdasarkan keadaan klinis yang ada

3.       Dapat diberikan:

-          Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

-          Extracorporeal membrane oxygenation

4.       Pengobatan simptomatik

-          Antiseptik di daerah mulut

-          Analgesik misal parasetamol

-          Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam

-          Pengobatan supportif lainnya (gizi dll)

Penyakit ini adalah self limiting diseases, yaitu dapat sembuh dengan sendirinya, dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun.  Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut di atas.

8. Pencegahan

Pencegahan dan Pengendalian Penyakit:

Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik.  Pencegahan penyakit ini adalah dengan mengilangkan kekumuhan dan kepadatan lingkungan; kebersihan (Higiene dan Sanitasi) lingkungan maupun perorangan,  Cara yang paling gampang dilakukan adalah misalnya membiasakan selalu cuci tangan, khususnya sehabis berdekatan dengan penderitam desinfektasi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.

Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang.  Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.

Di Rumah Sakit, Universal Precaution harus dilaksanakan.  Penyakit ini belum dapat dicegah dengan vaksin (imunisasi).

Upaya pemerintah dalam hal ini:

-          Meningkatkan survailans epidemiologi (perlu definisi klinik)

-          Memberikan penyuluhan tentang cara-cara penularan dan pencegahan PTKM untuk memotong rantai penularan.

-          Memberikan penyuluhan tentang tanda-tanda dan gejala PTKM

-          Menjaga kebersihan perorangan

-          Bila anak tidak dirawat, harus istirahat di rumah karena

-    Daya tahan tubuh menurun

-    Tidak menularkan ke Balita lainnya

-          Menyiapkan sarana kesehatan tentang tatalaksana PTKM termasuk pelaksanaan Universal Precautionnya.

 

Biografi BJ Habibi

Prof. DR (HC). Ing. Dr. Sc. Mult. Bacharuddin Jusuf Habibie atau dikenal sebagai BJ Habibie (73 tahun) merupakan pria Pare-Pare (Sulawesi Selatan) kelahiran 25 Juni 1936. Habibie menjadi Presiden ke-3 Indonesia selama 1.4 tahun dan 2 bulan menjadi Wakil Presiden RI ke-7. Habibie merupakan “blaster” antara orang Jawa [ibunya] dengan orang Makasar/Pare-Pare [ayahnya].
Dimasa kecil, Habibie telah menunjukkan kecerdasan dan semangat tinggi pada ilmu pengetahuan dan teknologi khususnya Fisika. Selama enam bulan, ia kuliah di Teknik Mesin Institut Teknologi Bandung (ITB), dan dilanjutkan ke Rhenisch Wesfalische Tehnische Hochscule – Jerman pada 1955. Dengan dibiayai oleh ibunya, R.A. Tuti Marini Puspowardoyo, Habibie muda menghabiskan 10 tahun untuk menyelesaikan studi S-1 hingga S-3 di Aachen-Jerman.
Berbeda dengan rata-rata mahasiswa Indonesia yang mendapat beasiswa di luar negeri, kuliah Habibie (terutama S-1 dan S-2) dibiayai langsung oleh Ibunya yang melakukan usaha catering dan indekost di Bandung setelah ditinggal pergi suaminya (ayah Habibie). Habibie mengeluti bidang Desain dan Konstruksi Pesawat di Fakultas Teknik Mesin. Selama lima tahun studi di Jerman akhirnya Habibie memperoleh gelar Dilpom-Ingenenieur atau diploma teknik (catatan : diploma teknik di Jerman umumnya disetarakan dengan gelar Master/S2 di negara lain) dengan predikat summa cum laude.
Pak Habibie melanjutkan program doktoral setelah menikahi teman SMA-nya, Ibu Hasri Ainun Besari pada tahun 1962. Bersama dengan istrinya tinggal di Jerman, Habibie harus bekerja untuk membiayai biaya kuliah sekaligus biaya rumah tangganya. Habibie mendalami bidang Desain dan Konstruksi Pesawat Terbang. Tahun 1965, Habibie menyelesaikan studi S-3 nya dan mendapat gelar Doktor Ingenieur (Doktor Teknik) dengan indeks prestasi summa cum laude.
Selama menjadi mahasiswa tingkat doktoral, BJ Habibie sudah mulai bekerja untuk menghidupi keluarganya dan biaya studinya. Setelah lulus, BJ Habibie bekerja di Messerschmitt-Bölkow-Blohm atau MBB Hamburg (1965-1969 sebagai Kepala Penelitian dan Pengembangan pada Analisis Struktrur Pesawat Terbang, dan kemudian menjabat Kepala Divisi Metode dan Teknologi pada industri pesawat terbang komersial dan militer di MBB (1969-1973). Atas kinerja dan kebriliannya, 4 tahun kemudian, ia dipercaya sebagai Vice President sekaligus Direktur Teknologi di MBB periode 1973-1978 serta menjadi Penasihast Senior bidang teknologi untuk Dewan Direktur MBB (1978 ). Dialah menjadi satu-satunya orang Asia yang berhasil menduduki jabatan nomor dua di perusahaan pesawat terbang Jerman ini.
Sebelum memasuki usia 40 tahun, karir Habibie sudah sangat cemerlang, terutama dalam desain dan konstruksi pesawat terbang. Habibie menjadi “permata” di negeri Jerman dan iapun mendapat “kedudukan terhormat”, baik secara materi maupun intelektualitas oleh orang Jerman. Selama bekerja di MBB Jerman, Habibie menyumbang berbagai hasil penelitian dan sejumlah teori untuk ilmu pengetahuan dan teknologi dibidang Thermodinamika, Konstruksi dan Aerodinamika. Beberapa rumusan teorinya dikenal dalam dunia pesawat terbang seperti “Habibie Factor“, “Habibie Theorem” dan “Habibie Method“.
Habibie merupakan presiden RI pertama yang menerima banyak penghargaan terutama di bidang IPTEK baik dari dalam negeri maupun luar negeri. Jasa-jasanya dalam bidang teknologi pesawat terbang mengantarkan beliau mendapat gelar Doktor Kehormatan (Doctor of Honoris Causa) dari berbagaai Universitas terkemuka dunia, antara lain Cranfield Institute of Technology dan Chungbuk University.

 
Tinggalkan komentar

Ditulis oleh pada 1 Maret 2011 in B.J HABIBI

 

Biografi Sir Isaac Newton : Ilmuwan paling berpengaruh yang pernah hidup di dunia.

.fullpost{display:inline;}

Sir Isaac Newton adalah seorang fisikawan, matematikawan, ahli astronomi dan juga ahli kimia yang berasal dari Inggris. Ia juga ilmuwan paling besar dan paling berpengaruh yang pernah hidup di dunia, lahir di Woolsthrope, Inggris, tepat pada hari Natal tahun 1642, bertepatan tahun dengan wafatnya Galileo. Seperti halnya Nabi Muhammad, dia lahir sesudah ayahnya meninggal Beliau merupakan pengikut aliran heliosentris dan ilmuwan yang sangat berpengaruh sepanjang sejarah, bahkan dikatakan sebagai bapak ilmu fisika

modern.

Masa-masa Awal Isaac Newton

Newton dilahirkan di kota Woolsthorpe-by-Colsterworth, hamlet di countyLincolnshire lahir secara prematur, dimana saat itu bayi prematur tidak diharapkan kehadirannya di dunia. Ayahnya, Isaac, meninggal tiga bulan sebelum kelahiran Newton, dan dua tahun kemudian ibunya, Hannah Ayscough Newton, menikah dengan lelaki lain dan meninggalkan Newton dengan neneknya. Newton merupakan kanak-kanak pintar.

Berdasarkan pernyataan E.T. Bell (1937, Simon and Schuster) dan H. Eves:

Newton memulai sekolah saat tinggal bersama neneknya di desa dan kemudian dikirimkan ke sekolah bahasa di daerah Grantham dimana dia akhirnya menjadi anak terpandai di sekolahnya. Saat bersekolah di Grantham dia tinggal di-kost milik apoteker lokal yang bernama William Clarke. Sebelum meneruskan kuliah di Universitas Cambridge pada usia 19, Newton sempat menjalin kasih dengan adik angkat William Clarke, Anne Storer. Saat Newton memfokuskan dirinya pada pelajaran, kisah cintanya dengan menjadi semakin tidak menentu dan akhirnya Storer menikahi orang lain. Banyak yang menegatakan bahwa dia, Newton, selalu mengenang kisah cintanya walaupun selanjutnya tidak pernah disebutkan Newton memiliki seorang kekasih dan bahkan pernah menikah.

 

Sejak usia 12 hingga 17 tahun, Newton mengenyam pendidikan di sekolah The Kings School yang terletak di Grantham (tanda tangannya masih terdapat di perpustakaan sekolah). Keluarganya mengeluarkan Newton dari sekolah dengan alasan agar dia menjadi petani saja, bagaimanapun Newton terlihat tidak menyukai pekerjaan barunya. Tapi pada akhirnya setelah meyakinkan keluarga dan ibunya dengan bantuan paman dan gurunya, Newton dapat menamatkan sekolah pada usia 18 tahun dengan nilai yang memuaskan.

Di masa bocah dia sudah menunjukkan kecakapan yang nyata di bidang mekanika dan teramat cekatan menggunakan tangannya. Meskipun anak dengan otak cemerlang, di sekolah tampaknya ogah-ogahan dan tidak banyak menarik perhatian. Tatkala menginjak akil baliq, ibunya mengeluarkannya dari sekolah dengan harapan anaknya bisa jadi petani yang baik. Untungnya sang ibu bisa dibujuk, bahwa bakat utamanya tidak terletak di situ.

Pada umurnya delapan belas dia masuk Universitas Cambridge. Di sinilah Newton secara kilat menyerap apa yang kemudian terkenal dengan ilmu pengetahuan dan matematik dan dengan cepat pula mulai melakukan penyelidikan sendiri. Antara usia dua puluh satu dan dua puluh tujuh tahun dia sudah meletakkan dasar-dasar teori ilmu pengetahuan yang pada gilirannya kemudian mengubah dunia.

Pertengahan abad ke-17 adalah periode pembenihan ilmu pengetahuan. Penemuan teropong bintang dekat permulaan abad itu telah merombak seluruh pendapat mengenai ilmu perbintangan. Filosof Inggris Francis Bacon dan Filosof Perancis Rene Descartes kedua-duanya berseru kepada ilmuwan seluruh Eropa agar tidak lagi menyandarkan diri pada kekuasaan Aristoteles, melainkan melakukan percobaan dan penelitian atas dasar titik tolak dan keperluan sendiri. Apa yang dikemukakan oleh Bacon dan Descartes, sudah dipraktekkan oleh si hebat Galileo. Penggunaan teropong bintang, penemuan baru untuk penelitian astronomi oleh Newton telah merevolusionerkan penyelidikan bidang itu, dan yang dilakukannya di sektor mekanika telah menghasilkan apa yang kini terkenal dengan sebutan “Hukum gerak Newton” yang pertama.

 

Dengan berbagai hasil karya ilmiah yang dicapainya, Newton menulis sebuah buku Philosophiae Naturalis Principia Mathematica, dimana pada buku tersebut dideskripsikan mengenai teori gravitasi secara umum, berdasarkan hukum gerak yang ditemukannya, dimana benda akan tertarik ke bawah karena gaya gravitasi. Bekerja sama dengan Gottfried Leibniz, Newton mengembangkan teori kalkulus. Newton merupakan orang pertama yang menjelaskan tentang teori gerak dan berperan penting dalam merumuskan gerakan melingkar dari hukum Kepler, dimana Newton memperluas hukum tersebut dengan beranggapan bahwa suatu orbit gerakan melingkar tidak harus selalu berbentuk lingkaran sempurna (seperti elipse, hiperbola dan parabola). Newton menemukan spektrum warna ketika melakukan percobaan dengan melewati sinar putih pada sebuah prisma, dia juga percaya bahwa sinar merupakan kumpulan dari partikel-partikel. Newton juga mengembangkan hukum tentang pendinginan yang di dapatkan dari teori binomial, dan menemukan sebuah prinsip momentum dan angular momentum.

Pendapat Kepala Akademi Ilmiah Berlin tentang Newton: “Newton ialah seorang jenius besar yang pernah ada dan paling beruntung, yang tak bisa kita temukan lebih dari suatu sistem dunia untuk didirikan.” [See Shapley.

 

Ilmuwan besar lain, seperti William Harvey, penemu ihwal peredaran darah dan Johannes Kepler penemu tata gerak planit-planit di seputar matahari, mempersembahkan informasi yang sangat mendasar bagi kalangan cendikiawan. Walau begitu, ilmu pengetahuan murni masih merupakan kegemaran para intelektual, dan masih belum dapat dibuktikan –apabila digunakan dalam teknologi– bahwa ilmu pengetahuan dapat mengubah pola dasar kehidupan manusia sebagaimana diramalkan oleh Francis Bacon.

Walaupun Copernicus dan Galileo sudah menyepak ke pinggir beberapa anggapan ngelantur tentang pengetahuan purba dan telah menyuguhkan pengertian yang lebih genah mengenai alam semesta, namun tak ada satu pokok pikiran pun yang terumuskan dengan seksama yang mampu membelokkan tumpukan pengertian yang gurem dan tak berdasar seraya menyusunnya dalam suatu teori yang memungkinkan berkembangnya ramalan-ramalan yang lebih ilmiah. Tak lain dari Isaac Newton-lah orangnya yang sanggup menyuguhkan kumpulan teori yang terangkum rapi dan meletakkan batu pertama ilmu pengetahuan modern yang kini arusnya jadi anutan orang.

Newton sendiri agak ogah-ogahan menerbitkan dan mengumumkan penemuan-penemuannya. Gagasan dasar sudah disusunnya jauh sebelum tahun 1669 tetapi banyak teori-teorinya baru diketahui publik bertahun-tahun sesudahnya. Penerbitan pertama penemuannya adalah menyangkut penjungkir-balikan anggapan lama tentang hal-ihwal cahaya. Dalam serentetan percobaan yang seksama, Newton menemukan fakta bahwa apa yang lazim disebut orang “cahaya putih” sebenarnya tak lain dari campuran semua warna yang terkandung dalam pelangi. Dan ia pun dengan sangat hati-hati melakukan analisa tentang akibat-akibat hukum pemantulan dan pembiasan cahaya. Berpegang pada hukum ini dia –pada tahun 1668– merancang dan sekaligus membangun teropong refleksi pertama, model teropong yang dipergunakan oleh sebagian terbesar penyelidik bintang-kemintang saat ini. Penemuan ini, berbarengan dengan hasil-hasil yang diperolehnya di bidang percobaan optik yang sudah diperagakannya, dipersembahkan olehnya kepada lembaga peneliti kerajaan Inggris tatkala ia berumur dua puluh sembilan tahun.

Keberhasilan Newton di bidang optik saja mungkin sudah memadai untuk mendudukkan Newton pada urutan daftar buku ini. Sementara itu masih ada penemuan-penemuan yang kurang penting di bidang matematika murni dan di bidang mekanika. Persembahan terbesarnya di bidang matematika adalah penemuannya tentang “kalkulus integral” yang mungkin dipecahkannya tatkala ia berumur dua puluh tiga atau dua puluh empat tahun. Penemuan ini merupakan hasil karya terpenting di bidang matematika modern. Bukan semata bagaikan benih yang daripadanya tumbuh teori matematika modern, tetapi juga perabot tak terelakkan yang tanpa penemuannya itu kemajuan pengetahuan modern yang datang menyusul merupakan hal yang mustahil. Biarpun Newton tidak berbuat sesuatu apapun lagi, penemuan “kalkulus integral”-nya saja sudah memadai untuk menuntunnya ke tangga tinggi dalam daftar urutan buku ini.

Tetapi penemuan-penemuan Newton yang terpenting adalah di bidang mekanika, pengetahuan sekitar bergeraknya sesuatu benda. Galileo merupakan penemu pertama hukum yang melukiskan gerak sesuatu obyek apabila tidak dipengaruhi oleh kekuatan luar. Tentu saja pada dasarnya semua obyek dipengaruhi oleh kekuatan luar dan persoalan yang paling penting dalam ihwal mekanik adalah bagaimana obyek bergerak dalam keadaan itu. Masalah ini dipecahkan oleh Newton dalam hukum geraknya yang kedua dan termasyhur dan dapat dianggap sebagai hukum fisika klasik yang paling utama. Hukum kedua (secara matcmatik dijabarkan dcngan persamaan F = m.a) menetapkan bahwa akselerasi obyek adalah sama dengan gaya netto dibagi massa benda. Terhadap kedua hukum itu Newton menambah hukum ketiganya yang masyhur tentang gerak (menegaskan bahwa pada tiap aksi, misalnya kekuatan fisik, terdapat reaksi yang sama dengan yang bertentangan) serta yang paling termasyhur penemuannya tentang kaidah ilmiah hukum gaya berat universal. Keempat perangkat hukum ini, jika digabungkan, akan membentuk suatu kesatuan sistem yang berlaku buat seluruh makro sistem mekanika, mulai dari pergoyangan pendulum hingga gerak planit-planit dalam orbitnya mengelilingi matahari yang dapat diawasi dan gerak-geriknya dapat diramalkan. Newton tidak cuma menetapkan hukum-hukum mekanika, tetapi dia sendiri juga menggunakan alat kalkulus matematik, dan menunjukkan bahwa rumus-rumus fundamental ini dapat dipergunakan bagi pemecahan problem.

Hukum Newton dapat dan sudah dipergunakan dalam skala luas bidang ilmiah serta bidang perancangan pelbagai peralatan teknis. Dalam masa hidupnya, pemraktekan yang paling dramatis adalah di bidang astronomi. Di sektor ini pun Newton berdiri paling depan. Tahun 1678 Newton menerbitkan buku karyanya yang masyhur Prinsip-prinsip matematika mengenai filsafat alamiah (biasanya diringkas Principia saja). Dalam buku itu Newton mengemukakan teorinya tentang hukum gaya berat dan tentang hukum gerak. Dia menunjukkan bagaimana hukum-hukum itu dapat dipergunakan untuk memperkirakan secara tepat gerakan-gerakan planit-planit seputar sang matahari. Persoalan utama gerak-gerik astronomi adalah bagaimana memperkirakan posisi yang tepat dan gerakan bintang-kemintang serta planit-planit, dengan demikian terpecahkan sepenuhnya oleh Newton hanya dengan sekali sambar. Atas karya-karyanya itu Newton sering dianggap seorang astronom terbesar dari semua yang terbesar.

Apa penilaian kita terhadap arti penting keilmiahan Newton? Apabila kita buka-buka indeks ensiklopedia ilmu pengetahuan, kita akan jumpai ihwal menyangkut Newton beserta hukum-hukum dan penemuan-penemuannya dua atau tiga kali lebih banyak jumlahnya dibanding ihwal ilmuwan yang manapun juga. Kata cendikiawan besar Leibniz yang sama sekali tidak dekat dengan Newton bahkan pernah terlibat dalam suatu pertengkaran sengit: “Dari semua hal yang menyangkut matematika dari mulai dunia berkembang hingga adanya Newton, orang itulah yang memberikan sumbangan terbaik.” Juga pujian diberikan oleh sarjana besar Perancis, Laplace: “Buku Principia Newton berada jauh di atas semua produk manusia genius yang ada di dunia.” Dan Langrange sering menyatakan bahwa Newton adalah genius terbesar yang pernah hidup. Sedangkan Ernst Mach dalam tulisannya di tahun 1901 berkata, “Semua masalah matematika yang sudah terpecahkan sejak masa hidupnya merupakan dasar perkembangan mekanika berdasar atas hukum-hukum Newton.” Ini mungkin merupakan penemuan besar Newton yang paling ruwet: dia menemukan wadah pemisahan antara fakta dan hukum, mampu melukiskan beberapa keajaiban namun tidak banyak menolong untuk melakukan dugaan-dugaan; dia mewariskan kepada kita rangkaian kesatuan hukum-hukum yang mampu dipergunakan buat permasalahan fisika dalam ruang lingkup rahasia yang teramat luas dan mengandung kemungkinan untuk melakukan dugaan-dugaan yang tepat.

Dalam uraian yang begini ringkas, adalah mustahil membeberkan secara terperinci penemuan-penemuan Newton. Akibatnya, banyak karya-karya yang agak kurang tenar terpaksa harus disisihkan biarpun punya makna penting di segi penemuan dalam bidang masalahnya sendiri. Newton juga memberi sumbangsih besar di bidang thermodinamika (penyelidikan tentang panas) dan di bidang akustik (ilmu tentang suara). Dan dia pulalah yang menyuguhkan penjelasan yang jernih bagai kristal prinsip-prinsip fisika tentang “pengawetan” jumlah gerak agar tidak terbuang serta “pengawetan” jumlah gerak sesuatu yang bersudut. Antrian penemuan ini kalau mau bisa diperpanjang lagi: Newtonlah orang yang menemukan dalil binomial dalam matematika yang amat logis dan dapat dipertanggungjawabkan. Mau tambah lagi? Dia juga, tak lain tak bukan, orang pertama yang mengutarakan secara meyakinkan ihwal asal mula bintang-bintang.

Nah, sekarang soalnya begini: taruhlah Newton itu ilmuwan yang paling jempol dari semua ilmuwan yang pernah hidup di bumi. Paling kemilau bagaikan batu zamrud di tengah tumpukan batu kali. Taruhlah begitu. Tetapi, bisa saja ada orang yang mempertanyakan alasan apa menempatkan Newton di atas pentolan politikus raksasa seperti Alexander Yang Agung atau George Wasington, serta disebut duluan ketimbang tokoh-tokoh agama besar seperti Nabi Isa atau Budha Gautama. Kenapa mesti begitu?

Pertimbangan saya begini. Memang betul perubahan-perubahan politik itu penting kalau tidak teramat penting. Walau begitu, bagaimanapun juga pada umumnya manusia sebagaian terbesar hidup nyaris tak banyak beda antara mereka di jaman lima ratus tahun sesudah Alexander wafat dengan mereka di jaman lima ratus sebelum Alexander muncul dari rahim ibunya. Dengan kata lain, cara manusia hidup di tahun 1500 sesudah Masehi boleh dibilang serupa dengan cara hidup buyut bin buyut bin buyut mereka di tahun 1500 sebelum Masehi. Sekarang, tengoklah dari sudut perkembangan ilmu pengetahuan. Dalam lima abad terakhir, berkat penemuan-penemuan ilmiah modern, cara hidup manusia sehari-hari sudah mengalami revolusi besar. Cara berbusana beda, cara makan beda, cara kerja dan ragamnya beda. Bahkan, cara hidup santai berleha-leha pun sama sekali tidak mirip dengan apa yang diperbuat orang jaman tahun 1500 sesudah Masehi. Penemuan ilmiah bukan saja sudah merevolusionerkan teknologi dan ekonomi, tetapi juga sudah mengubah total segi politik, pemikiran keagamaan, seni dan falsafah. Sangat langkalah aspek kehidupan manusia yang tetap “jongkok di tempat” tak beringsut sejengkal pun dengan adanya revolusi ilmiah. Alasan ini –sekali lagi alasan ini– yang jadi sebab mengapa begitu banyak ilmuwan dan penemu gagasan baru tercantum di dalam daftar buku ini. Newton bukan semata yang paling cerdas otak diantara barisan cerdas otak, tetapi sekaligus dia tokoh yang paling berpengaruh di dalam perkembangan teori ilmu. Itu sebabnya dia peroleh kehormatan untuk didudukkan dalam urutan hampir teratas dari sekian banyak manusia yang paling berpengaruh dalam sejarah manusia. Newton menghembuskan nafas penghabisan tahun 1727, dikebumikan di Westminster Abbey, ilmuwan pertama yang memperoleh penghormatan macam itu.

 
Tinggalkan komentar

Ditulis oleh pada 27 Februari 2011 in isaac newton

 

Louis Pasteur (1822-1895); bapak biologi sel dan molekulerQuantcast

//
PDRTJS_settings_1129809_post_73={“id”:1129809,”unique_id”:”wp-post-73″,”title”:”Louis Pasteur (1822-1895); bapak biologi sel dan molekuler”,”permalink”:”http:\/\/tentangbiografi.wordpress.com\/2010\/01\/06\/louis-pasteur-1822-1895-bapak-biologi-sel-dan-molekuler\/”,”item_id”:”_post_73″}
//
Ahli kimia dan biolog Perancis, Louis Pasteur, umumnya dianggap jempolan bin jempolan dalam sejarah obat-obatan. Pasteur memang menyuguhkan banyak sumbangan pikiran penting bagi kepentingan ilmu pengetahuan. Tetapi yang paling menonjol pada dirinya ialah pendapatnya tentang teori baksil penyakit dan pengembangan teknik pencegahan lewat penyuntikan.
Pasteur lahir di kota Dole tahun 1822, bagian timur Perancis. Sebagai mahasiswa di Paris dia memperdalam ilmu pengetahuan. Kegeniusannya belum tampak tatkala jadi mahasiswa bahkan salah seorang mahagurunya menganggap Pasteur “sedang-sedang” saja dalam ilmu kimia. Baru sesudah dia meraih gelar Doktor di tahun 1847, Pasteur membuktikan ucapan profesornya keliru besar. Penyelidikannya tentang asam traktat (tartaric acid) pada kaca mengangkat derajatnya ke tingkat ahli kimia yang tersohor di saat umurnya baru dua puluh enam tahun.
Kemudian dia mengalihkan perhatiannya kepada penyelidikan tentang peragian dan membuktikan bahwa proses ini persis seperti proses yang terjadi pada sejenis mikro organisme lainnya dapat memprodusir hasil-hasil yang tidak dikehendaki dalam hal peragian minuman. Pendapat ini segera menuntunnya kegagasan lain bahwa semacam mikro organisme dapat pula menghasilkan hal-hal yang tidak diharapkan dan dapat membawa pengaruh baik terhadap manusia maupun hewan.
Pasteur bukanlah orang pertama yang memasalahkan teori baksil penyakit. Hipotesa serupa telah pernah dikembangkan lebih dulu oleh Girolamo Fracastoro, Friedrich Henle dan banyak lainnya lagi. Tetapi, Pasteurlah yang paling menonjol dalam hal teori kuman penyakit yang dibuktikannya lewat serentetan percobaan dan demonstrasi yang merupakan faktor utama dan meyakinkan masyarakat cerdik pandai bahwa teorinya benar.
Apabila penyakit disebabkan oleh baksil, tampaknya masuk akal bahwa dengan mencegah masuknya baksil itu ke dalam tubuh manusia, penyakit itu bisa dihindari. Karena itu Pasteur menekankan pentingnya metode antiseptik buat para dokter, dan dia punya pengaruh besar terhadap Joseph Lister yang memperkenalkan cara antiseptik kedalam bidang pembedahan.
Bakteri yang berbahaya dapat memasuki tubuh manusia lewat makanan dan minuman. Pasteur mengembangkan teknik (biasa disebut pasteurisasi) untuk memusnahkan mikro organisme dalam minuman. Teknik ini, jika dipraktekkan, dapat membinasakan susu yang kejangkitan hama sebagai penyebab infeksi.
Tatkala umurnya mendekati pertengahan lima puluhan, Pasteur beralih lagi perhatiannya kepada penyelidikan baksil penyakit ternak, sejenis penyakit infeksi serius yang menyerang binatang ternak dan binatang-binatang lain, tidak kecuali manusia. Pasteur mampu menunjukkan bahwa sejenis baksil menjadi sebab sesuatu penyakit. Karya lebih penting lainnya ialah pengembangan tekniknya memproduksi corak baksil penyakit ternak yang sudah dilemahkan. Dengan cara disuntikkan ke tubuh ternak, baksil penyakit yang sudah dilemahkan ini dapat menimbulkan penyakit yang ringan dan tidak mengakibatkan fatal sehingga memungkinkan ternak-ternak itu memperoleh kekebalan untuk menghadapi penyakit normal. Demonstrasi Pasteur di depan umum mengenai efektivitas teknik mengebalkan hewan dari baksil penyakit ternak menimbulkan kegemparan. Segera disadari bahwa metode umum dapat digunakan untuk pencegahan rupa-rupa penyakit masyarakat.
Pasteur dalam laboratoriumnya
Penemuan pribadi Pasteur yang paling termasyhur adalah pengembangan teknik penyuntikan terhadap manusia untuk mencegah penyakit Rabies yang ditakuti. Lain-lain ilmuwan, dengan meniru gagasan dasar Pasteur, sejak itu mengembangkan vaksin untuk mencegah lain-lain penyakit berat seperti tifus dan poliomyelitis.
Pasteur, seorang yang suka kerja luar biasa banyak, menciptakan penemuan-penemuan kurang penting namun tetap berguna bagi keharuman namanya. Adalah tak lain dari penemuannya –melebihi arti penemuan orang-orang lain– yang secara meyakinkan mendemonstrasikan bahwa mikro organisme tidak tumbuh lewat pembiakan. Pasteur juga menemukan fenomena anaerobiosis, misalnya sesuatu mikro organisme dapat hidup dalam ketiadaan udara maupun oksigen. Karya Pasteur mengenai penyakit ulat sutera mendatangkan nilai komersial yang tinggi. Penemuan lainnya adalah pengembangan vaksin untuk mencegah berjangkitnya penyakit kolera pada ayam dan penyakit yang menyerang unggas. Pasteur menghembuskan nafas terakhir di dekat Paris tahun 1895.

 
Tinggalkan komentar

Ditulis oleh pada 27 Februari 2011 in lois pasteur

 

Biografi   Albert  Einstein

Albert Einstein (14 Maret 1879–18 April 1955) adalah seorang ilmuwan fisika teoretis yang dipandang luas sebagai ilmuwan terbesar dalam abad ke-20. Dia mengemukakan teori relativitas dan juga banyak menyumbang bagi pengembangan mekanika kuantum, mekanika statistik, dan kosmologi. Dia dianugerahi Penghargaan Nobel dalam Fisika pada tahun 1921 untuk penjelasannya tentang efek fotoelektrik dan “pengabdiannya bagi Fisika Teoretis”. Setelah teori relativitas umum dirumuskan, Einstein menjadi terkenal ke seluruh dunia, pencapaian yang tidak biasa bagi seorang ilmuwan. Di masa tuanya, keterkenalannya melampaui ketenaran semua ilmuwan dalam sejarah, dan dalam budaya populer, kata Einstein dianggap bersinonim dengan kecerdasan atau bahkan jenius. Wajahnya merupakan salah satu yang paling dikenal di seluruh dunia. Pada tahun 1999, Einstein dinamakan “Orang Abad Ini” oleh majalah Time. Kepopulerannya juga membuat nama “Einstein” digunakan secara luas dalam iklan dan barang dagangan lain, dan akhirnya “Albert Einstein” didaftarkan sebagai merk dagang. Untuk menghargainya, sebuah satuan dalam fotokimia dinamai einstein, sebuah unsur kimia dinamai einsteinium, dan sebuah asteroid dinamai 2001 Einstein.

Biografi

1. Masa muda dan universitas

Einstein dilahirkan di Ulm di Württemberg, Jerman; sekitar 100 km sebelah timur Stuttgart. Bapaknya bernama Hermann Einstein, seorang penjual ranjang bulu yang kemudian menjalani pekerjaan elektrokimia, dan ibunya bernama Pauline. Mereka menikah di Stuttgart-Bad Cannstatt. Keluarga mereka keturunan Yahudi; Albert disekolahkan di sekolah Katholik dan atas keinginan ibunya dia diberi pelajaran biola. Pada umur lima, ayahnya menunjukkan kompas kantung, dan Einstein menyadari bahwa sesuatu di ruang yang “kosong” ini beraksi terhadap jarum di kompas tersebut; dia kemudian menjelaskan pengalamannya ini sebagai salah satu saat yang paling menggugah dalam hidupnya. Meskipun dia membuat model dan alat mekanik sebagai hobi, dia dianggap sebagai pelajar yang lambat, kemungkinan disebabkan oleh dyslexia, sifat pemalu, atau karena struktur yang jarang dan tidak biasa pada otaknya (diteliti setelah kematiannya).

Dia kemudian diberikan penghargaan untuk teori relativitasnya karena kelambatannya ini, dan berkata dengan berpikir dalam tentang ruang dan waktu dari anak-anak lainnya, dia mampu mengembangkan kepandaian yang lebih berkembang. Pendapat lainnya, berkembang belakangan ini, tentang perkembangan mentalnya adalah dia menderita Sindrom Asperger, sebuah kondisi yang berhubungan dengan autisme. Einstein mulai belajar matematika pada umur dua belas tahun. Ada gosip bahwa dia gagal dalam matematika dalam jenjang pendidikannya, tetapi ini tidak benar; penggantian dalam penilaian membuat bingung pada tahun berikutnya. Dua pamannya membantu mengembangkan ketertarikannya terhadap dunia intelek pada masa akhir kanak-kanaknya dan awal remaja dengan memberikan usulan dan buku tentang sains dan matematika. Pada tahun 1894, dikarenakan kegagalan bisnis elektrokimia ayahnya, Einstein pindah dari Munich ke Pavia, Italia (dekat Milan). Albert tetap tinggal untuk menyelesaikan sekolah, menyelesaikan satu semester sebelum bergabung kembali dengan keluarganya di Pavia. Kegagalannya dalam seni liberal dalam tes masuk Eidgenössische Technische Hochschule (Institut Teknologi Swiss Federal, di Zurich) pada tahun berikutnya adalah sebuah langkah mundur;j dia oleh keluarganya dikirim ke Aarau, Swiss, untuk menyelesaikan sekolah menengahnya, di mana dia menerima diploma pada tahun 1896, Einstein beberapa kali mendaftar di Eidgenössische Technische Hochschule. Pada tahun berikutnya dia melepas kewarganegaraan Württemberg, dan menjadi tak bekewarganegaraan.

Pada 1898, Einstein menemui dan jatuh cinta kepada Mileva Maric, seorang Serbia yang merupakan teman kelasnya (juga teman Nikola Tesla). Pada tahun 1900, dia diberikan gelar untuk mengajar oleh Eidgenössische Technische Hochschule dan diterima sebagai warga negar Swiss pada 1901. Selama masa ini Einstein mendiskusikan ketertarikannya terhadap sains kepada teman-teman dekatnya, termasuk Mileva. Dia dan Mileva memiliki seorang putri bernama Lieserl, lahir dalam bulan Januari tahun 1902. Lieserl, pada waktu itu, dianggap tidak legal karena orang tuanya tidak menikah.

2. Kerja dan Gelar Doktor

Pada saat kelulusannya Einstein tidak dapat menemukan pekerjaan mengajar, keterburuannya sebagai orang muda yang mudah membuat marah professornya. Ayah seorang teman kelas menolongnya mendapatkan pekerjaan sebagai asisten teknik pemeriksa di Kantor Paten Swiss dalah tahun 1902. Di sana, Einstein menilai aplikasi paten penemu untuk alat yang memerlukan pengatahuan fisika. Dia juga belajar menyadari pentingnya aplikasi dibanding dengan penjelasan yang buruk, dan belajar dari direktur bagaimana “menjelaskan dirinya secara benar”. Dia kadang-kadang membetulkan desain mereka dan juga mengevaluasi kepraktisan hasil kerja mereka. Einstein menikahi Mileva pada 6 Januari 1903. Pernikahan Einstein dengan Mileva, seorang matematikawan, adalah pendamping pribadi dan kepandaian; Pada 14 Mei 1904, anak pertama dari pasangan ini, Hans Albert Einstein, lahir. Pada 1904, posisi Einstein di Kantor Paten Swiss menjadi tetap. Dia mendapatkan gelar doktor setelah menyerahkan thesis “Eine neue Bestimmung der Moleküldimensionen” (“On a new determination of molecular dimensions”) dalam tahun 1905 dari Universitas Zürich.

Di tahun yang sama dia menulis empat artikel yang memberikan dasar fisika modern, tanpa banyak sastra sains yang dapat ia tunjuk atau banyak kolega dalam sains yang dapat ia diskusikan tentang teorinya. Banyak fisikawan setuju bahwa ketiga thesis itu (tentang gerak Brownian), efek fotoelektrik, dan relativitas spesial) pantas mendapat Penghargaan Nobel. Tetapi hanya thesis tentang efek fotoelektrik yang mendapatkan penghargaan tersebut. Ini adalah sebuah ironi, bukan hanya karena Einstein lebih tahu banyak tentang relativitas, tetapi juga karena efek fotoelektrik adalah sebuah fenomena kuantum, dan Einstein menjadi terbebas dari jalan dalam teori kuantum. Yang membuat thesisnya luar biasa adalah, dalam setiap kasus, Einstein dengan yakin mengambil ide dari teori fisika ke konsekuensi logis dan berhasil menjelaskan hasil eksperimen yang membingungkan para ilmuwan selama beberapa dekade. Dia menyerahkan thesis-thesisnya ke “Annalen der Physik”. Mereka biasanya ditujukan kepada “Annus Mirabilis Papers” (dari Latin: Tahun luar biasa). Persatuan Fisika Murni dan Aplikasi (IUPAP) merencanakan untuk merayakan 100 tahun publikasi pekerjaan Einstein di tahun 1905 sebagai Tahun Fisika 2005.

3. Gerakan Brownian

Di artikel pertamanya di tahun 1905 bernama “On the Motion—Required by the Molecular Kinetic Theory of Heat—of Small Particles Suspended in a Stationary Liquid”, mencakup penelitian tentang gerakan Brownian. Menggunakan teori kinetik cairan yang pada saat itu kontroversial, dia menetapkan bahwa fenomena, yang masih kurang penjelasan yang memuaskan setelah beberapa dekade setlah ia pertama kali diamati, memberikan bukti empirik (atas dasar pengamatan dan eksperimen) kenyataan pada atom. Dan juga meminjamkan keyakinan pada mekanika statistika, yang pada saat itu juga kontroversial. Sebelum thesis ini, atom dikenal sebagai konsep yang berguan, tetapi fisikawan dan kimiawan berdebat dengan sengit apakah atom benar suatu benda yang nyata. Diskusi statistik Einstein tentang kelakuan atom memberikan pelaku eksperimen sebuah cara untuk menghitung atom hanya dengan melihat melalui mikroskop biasa. Wilhelm Ostwald, seorang pemimpin sekolah anti-atom, kemudian memberitahu Arnold Sommerfeld bahwa ia telah berkonversi kepada penjelasan komplit Einstein tentang gerakan Brownian.

Keterangan :
Cerita ini saya Copy dari situs http://www.wikipedia.net
Saya tidak bisa menjamin kebenaran, keaslian dan kelengkapan cerita ini, saya mengcopy nya hanya untuk memenuhi permintaan pengguna sebagai bahan pelajaran, untuk lebih jelasnya silahkan Anda menuju situs tersebut, disana Anda dapat memperbaiki atau mengedit cerita yang menurut versi Anda adalah yang benar dan terjamin keasliannya.

 
Tinggalkan komentar

Ditulis oleh pada 27 Februari 2011 in albert einstein

 
 
Ikuti

Get every new post delivered to your Inbox.